KIAA1149

Product ID	ORK04248
Accession No	AB032975
Description	beta-site APP-cleaving enzyme 1
Clone name	fg04087
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5814 bp) Predicted protein sequence (532 aa)
Source	Human fetal brain
Rouge ID	mKIAA1149 by Kazusa Mouse cDNA Project
Note	We replaced hg01289, former representative clones for KIAA1149 with fg04087. (2001/5/29)

Length: 5814 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3865 bp
Genome contig ID	gi51511727r_116561627
PolyA signal sequence (AGTAAA,-23)	+--------+--------+----*----+---- GAGCGTTAACACAGTAAAATATTCAATAAGAAGTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAACTACTAGGGTTACTTTTTTTTCCTCAATCAGAGTCTCATTTTATCCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	r	116661627	116692163	9	99.2	Perfect prediction

Length: 532 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P56817	5.9e-191	96.3	Beta-secretase ...	Homo sapiens
AAF13715	1.4e-190	97.3	memapsin 2 [Hom...	Homo sapiens
AAH36084	1.9e-190	96.1	Beta-site APP-c...	Homo sapiens
ACA05927	2.9e-190	96.1	beta-secretase ...	Homo sapiens
XP_001094263	3.8e-190	95.9	beta-site APP-c...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR009120	88	114	PR01816	Peptidase A1
	IPR009119	94	113	PR01815	Peptidase A1
	IPR001461	112	132	PR00792	Peptidase A1
	IPR009119	124	152	PR01815	Peptidase A1
	IPR001461	264	277	PR00792	Peptidase A1
	IPR009119	299	323	PR01815	Peptidase A1
	IPR001461	317	328	PR00792	Peptidase A1
	IPR009120	398	407	PR01816	Peptidase A1
	IPR001461	423	438	PR00792	Peptidase A1
	IPR009120	452	463	PR01816	Peptidase A1
HMMPfam	IPR001461	105	449	PF00026	Peptidase A1
ScanRegExp	IPR001969	121	132	PS00141	Peptidase aspartic

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	487	MTIAYVMAAICALFMLPLCLMVC	509	PRIMARY	23

Primer_f	TCTAGCTCGGAACTTACTGTG
Primer_r	ATAATAGGCTGATGGGACTTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GAAAATAGGGTGGACAGAAGC
Primer_r	TCACAGTCCGAGAATAACAAC
PCR product length	77 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles