Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK04248 |
---|---|
Accession No | AB032975 |
Description | beta-site APP-cleaving enzyme 1 |
Clone name | fg04087 |
Vector information | |
cDNA sequence | DNA sequence (5814 bp) Predicted protein sequence (532 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1149
by Kazusa Mouse cDNA Project
|
Note | We replaced hg01289, former representative clones for KIAA1149 with fg04087. (2001/5/29) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 3865 bp |
---|---|
Genome contig ID | gi51511727r_116561627 |
PolyA signal sequence (AGTAAA,-23) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 11 | r | 116661627 | 116692163 | 9 | 99.2 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR009120 | 88 | 114 | PR01816 | Peptidase A1 |
IPR009119 | 94 | 113 | PR01815 | Peptidase A1 | |
IPR001461 | 112 | 132 | PR00792 | Peptidase A1 | |
IPR009119 | 124 | 152 | PR01815 | Peptidase A1 | |
IPR001461 | 264 | 277 | PR00792 | Peptidase A1 | |
IPR009119 | 299 | 323 | PR01815 | Peptidase A1 | |
IPR001461 | 317 | 328 | PR00792 | Peptidase A1 | |
IPR009120 | 398 | 407 | PR01816 | Peptidase A1 | |
IPR001461 | 423 | 438 | PR00792 | Peptidase A1 | |
IPR009120 | 452 | 463 | PR01816 | Peptidase A1 | |
HMMPfam | IPR001461 | 105 | 449 | PF00026 | Peptidase A1 |
ScanRegExp | IPR001969 | 121 | 132 | PS00141 | Peptidase aspartic |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 487 | MTIAYVMAAICALFMLPLCLMVC | 509 | PRIMARY | 23 |
---|
RT-PCR-ELISA |
Primer_f | TCTAGCTCGGAACTTACTGTG |
---|---|
Primer_r | ATAATAGGCTGATGGGACTTG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GAAAATAGGGTGGACAGAAGC |
Primer_r | TCACAGTCCGAGAATAACAAC |
PCR product length | 77 bp |
PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |