KIAA1426

Product ID	ORK01164
Accession No	AB037847
Description	Crm, cramped-like (Drosophila)
Clone name	fg04231s1
Vector information	The cDNA fragment was originally inserted at PvuI-NotI site ... The cDNA fragment was originally inserted at PvuI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR) and a RT-PCR product (1-1296) was subcloned upstream of the cDNA (1297-7064). The adjacent sequence to the 5' end of the cDNA is as follows: GGTACCACAA GTTTGTACAA AAAAGCAGGC TGTCGACGGT ATCGATAAGC TTGATT-5' end of cDNA
cDNA sequence	DNA sequence (7064 bp) Predicted protein sequence (1066 aa)
HaloTag ORF Clone	FHC01164
Flexi ORF Clone	FXC01164
Source	Human fetal brain
Rouge ID	mKIAA1426 by Kazusa Mouse cDNA Project
Note	We replaced fg04231, former representative clones for KIAA1426 with fg04231s1. (2000/3/14)

Length: 7064 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3861 bp
Genome contig ID	gi51511732f_1522281
PolyA signal sequence (CATAAA,-25)	+--------+--------+----*----+---- TTTTATTGTGCATAAATACATACTAATGTTGATCT
Flanking genome sequence (145629 - 145678)	----+--------+--------+--------+--------+----* AAGGACTGTCGTTTGTGCCTGTTCTTCAGGGCCGCGCGCCCATGCCCGCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	f	1622281	1667908	18	99.2	Perfect prediction

Length: 1066 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI52478	100.0	Crm, cramped-li...	Homo sapiens
Q96RY5	99.8	Protein cramped...	Homo sapiens
CAM26477	99.8	Crm, cramped-li...	Homo sapiens
AAI37173	99.8	Crm, cramped-li...	Homo sapiens
XP_598762	84.3	similar to Prot...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	GTCTTGTAGCTGTAGGGTGCC
Primer_r	GTTATCCACCAGAAATGAGGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 16

Experimental conditions

Panel name	GeneBridge 4
Primer_f	GTCTTGTAGCTGTAGGGTGCC
Primer_r	GTTATCCACCAGAAATGAGGC
PCR product length	129 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles