KIAA0459

Product ID	ORK00081
Accession No	AB007928
Description	OTU deubiquitinase 3
Clone name	fg05396
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone fg05396 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCGG ACGCGTGGG) instead of regular one (GTCGACCCAC GCGTCCG).
cDNA sequence	DNA sequence (6489 bp) Predicted protein sequence (430 aa)
HaloTag ORF Clone	FHC00081
Flexi ORF Clone	FXC00081
Source	Human fetal brain
Note	We replaced hg00766, former representative clones for KIAA0459 with fg05396. (1998/8/13)

Length: 6489 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	5196 bp
Genome contig ID	gi89161185f_19981498
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- GAGTTTTGTATACCAATAAATTCTAGTTTAAAAAC
Flanking genome sequence (130526 - 130575)	----+--------+--------+--------+--------+----* AAAGTTTTAAGTTGTTTTTATCAGTATCTGACCACCGTTTGAGTGAATGC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	20081497	20112022	8	100.0	Perfect prediction

Length: 430 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_513073	1.2e-164	99.1	OTU domain cont...	Pan troglodytes
XP_001107780	5.1e-160	97.0	OTU domain cont...	Macaca mulatta
Q5T2D3	2.7e-151	100.0	OTU domain-cont...	Homo sapiens
BAE90570	5.8e-148	98.0	unnamed protein...	Macaca fascicularis
XP_131770	5.8e-124	79.6	OTU domain cont...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003323	103	215	PF02338	Ovarian tumour
ProfileScan	IPR003323	97	221	PS50802	Ovarian tumour

Primer_f
Primer_r
PCR conditions	°C sec °C sec cycles

Panel name	GeneBridge 4
Primer_f	AACAATCTAGGGGGAAGGAAC
Primer_r	GATACTTAAGACCTCCATGGG
PCR product length	124 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles