Order Kazusa clone(s) from : ![]() |
Product ID | ORK00094 |
---|---|
Accession No | AB011113 |
Description | WD repeat domain 7, transcript variant 1 |
Clone name | fg05763 |
Vector information | |
cDNA sequence | DNA sequence (7234 bp) Predicted protein sequence (1500 aa) |
HaloTag ORF Clone |
FHC00094
![]() |
Flexi ORF Clone | FXC00094 |
Source | Human fetal brain |
Rouge ID |
mKIAA0541
by Kazusa Mouse cDNA Project
|
Note | We replaced hg04294, former representative clones for KIAA0541 with fg05763. (2005/08/06) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 2587 bp |
---|---|
Genome contig ID | gi51511735f_52369651 |
PolyA signal sequence (AATAAA,-18) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (478370 - 478419) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 18 | f | 52469651 | 52848019 | 28 | 99.6 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001680 | 44 | 58 | PR00320 | WD40 repeat |
IPR001680 | 495 | 509 | PR00320 | WD40 repeat | |
IPR001680 | 585 | 599 | PR00320 | WD40 repeat | |
HMMPfam | IPR001680 | 19 | 57 | PF00400 | WD40 repeat |
IPR001680 | 64 | 105 | PF00400 | WD40 repeat | |
IPR001680 | 464 | 508 | PF00400 | WD40 repeat | |
IPR001680 | 560 | 598 | PF00400 | WD40 repeat | |
IPR001680 | 1394 | 1421 | PF00400 | WD40 repeat | |
HMMSmart | IPR001680 | 15 | 57 | SM00320 | WD40 repeat |
IPR001680 | 63 | 105 | SM00320 | WD40 repeat | |
IPR001680 | 218 | 252 | SM00320 | WD40 repeat | |
IPR001680 | 463 | 508 | SM00320 | WD40 repeat | |
IPR001680 | 511 | 556 | SM00320 | WD40 repeat | |
IPR001680 | 559 | 598 | SM00320 | WD40 repeat | |
IPR001680 | 1393 | 1433 | SM00320 | WD40 repeat | |
ProfileScan | IPR001680 | 25 | 114 | PS50294 | WD40 repeat |
IPR001680 | 32 | 59 | PS50082 | WD40 repeat | |
IPR001680 | 470 | 517 | PS50082 | WD40 repeat | |
IPR001680 | 470 | 607 | PS50294 | WD40 repeat | |
IPR001680 | 566 | 607 | PS50082 | WD40 repeat | |
IPR001680 | 1400 | 1436 | PS50082 | WD40 repeat | |
IPR001680 | 1400 | 1442 | PS50294 | WD40 repeat | |
ScanRegExp | IPR001680 | 44 | 58 | PS00678 | WD40 repeat |
IPR001680 | 495 | 509 | PS00678 | WD40 repeat |
![]() |
---|
Primer_f | CCTGTCCTTGTATATGTAGAG |
---|---|
Primer_r | ACATTCAGCACACATAGAGTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CCTGTCCTTGTATATGTAGAG |
Primer_r | ACATTCAGCACACATAGAGTC |
PCR product length | 188 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |