KIAA1209

Product ID	ORK06396
Accession No	AB033035
Description	pleckstrin homology domain containing, family G (with RhoGef domain) member 1
Clone name	fg05970
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6110 bp) Predicted protein sequence (1113 aa)
Source	Human fetal brain
Rouge ID	mKIAA1209 by Kazusa Mouse cDNA Project

Length: 6110 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2767 bp
Genome contig ID	gi89161210f_151067474
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- GTCCATTATTTAATAAAGTTTGTAAAGTACAAGGT
Flanking genome sequence (139020 - 139069)	----+--------+--------+--------+--------+----* AATTTATAGTGTGAATTAATGTGTTTATTTTAGAACATCAAGATGTTTCC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	f	151167474	151206492	10	100.0	Perfect prediction

Length: 1113 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH89428	100.0	PLEKHG1 protein...	Homo sapiens
Q9ULL1	100.0	Pleckstrin homo...	Homo sapiens
BAG10439	100.0	pleckstrin homo...	synthetic construct
XP_001135825	99.2	pleckstrin homo...	Pan troglodytes
XP_001135904	99.2	pleckstrin homo...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001849	52	144	PF00169	Pleckstrin-like
HMMSmart	IPR001849	52	146	SM00233	Pleckstrin-like
ProfileScan	IPR001849	45	144	PS50003	Pleckstrin-like

Primer_f	TTATCACAGGTCCCAGTCATC
Primer_r	TTCTGTGAGTCTTGGAGTGTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-