Order Kazusa clone(s) from : ![]() |
Product ID | ORK00120 |
---|---|
Accession No | AB018275 |
Description | SMG6 nonsense mediated mRNA decay factor, transcript variant 1 |
Clone name | fg05988b |
Vector information | |
cDNA sequence | DNA sequence (6002 bp) Predicted protein sequence (1449 aa) |
HaloTag ORF Clone |
FHC00120
![]() |
Flexi ORF Clone | FXC00120 |
Source | Human fetal brain |
Rouge ID |
mKIAA0732
by Kazusa Mouse cDNA Project
|
Note | We replaced hk03717, former representative clones for KIAA0732 with fg05988b. (2001/5/29) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | Warning |
Length of 3'UTR | 1650 bp |
---|---|
Genome contig ID | gi51511734r_1809888 |
PolyA signal sequence (AATAAA,-24) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 17 | r | 1909888 | 2153826 | 19 | 99.4 | Terminal No-hit |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | TCTTCCCCTTCTAGTTGATCC |
---|---|
Primer_r | CTGTACTAGGTTCCTGCCATG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |