Order Kazusa clone(s) from : ![]() |
Product ID | ORK04262 |
---|---|
Accession No | AB040879 |
Description | brain-enriched guanylate kinase-associated |
Clone name | fg06734 |
Vector information | |
cDNA sequence | DNA sequence (5806 bp) Predicted protein sequence (645 aa) |
Source | Human fetal brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 816 bp |
---|---|
Genome contig ID | gi51511730r_99973243 |
PolyA signal sequence (AATAAA,-18) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 14 | r | 100073243 | 100085979 | 5 | 99.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
None | - | - | - | - | - |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 4 | GWVCVSVCVCVCVCVR | 19 | PRIMARY | 16 |
---|
![]() |
Primer_f | GGATTCAGAGCAACTACATGG |
---|---|
Primer_r | TTGCAGTCCTTCCTATAGAGC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TTTCTTAACGCACTTGGCCTC |
Primer_r | CCTCTTCGTGGACACAACTTC |
PCR product length | 211 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |