Order Kazusa clone(s) from : ![]() |
Product ID | ORK04502 |
---|---|
Accession No | AB028951 |
Description | cyclin-dependent kinase 19 |
Clone name | fh00176s1 |
Vector information | |
cDNA sequence | DNA sequence (6063 bp) Predicted protein sequence (501 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1028
by Kazusa Mouse cDNA Project
|
Note | We replaced fh00176, former representative clones for KIAA1028 with fh00176s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 4557 bp |
---|---|
Genome contig ID | gi89161210r_110937874 |
PolyA signal sequence (AATAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 6 | r | 111037874 | 111243029 | 12 | 100.0 | Internal No-hit |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR000719 | 27 | 239 | PD000001 | Protein kinase |
HMMPfam | IPR000719 | 19 | 334 | PF00069 | Protein kinase |
HMMSmart | IPR001245 | 20 | 332 | SM00219 | Tyrosine protein kinase |
IPR002290 | 20 | 334 | SM00220 | Serine/threonine protein kinase | |
ProfileScan | IPR000719 | 20 | 334 | PS50011 | Protein kinase |
ScanRegExp | IPR000719 | 26 | 51 | PS00107 | Protein kinase |
IPR008271 | 146 | 158 | PS00108 | Serine/threonine protein kinase |
![]() |
Primer_f | ACTATGAGGCTGAAACAATCC |
---|---|
Primer_r | CAAAAGAGTAGTGCAGAAGGC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | ACTATGAGGCTGAAACAATCC |
Primer_r | CAAAAGAGTAGTGCAGAAGGC |
PCR product length | 139 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |