Order Kazusa clone(s) from : ![]() |
Product ID | ORK05501 |
---|---|
Accession No | AB028953 |
Description | immunoglobulin superfamily, member 9B |
Clone name | fh00432 |
Vector information | |
cDNA sequence | DNA sequence (5319 bp) Predicted protein sequence (763 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1030
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 3027 bp |
---|---|
Genome contig ID | gi51511727r_133190623 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (99773 - 99724) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 11 | r | 133290396 | 133302069 | 8 | 99.4 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR003961 | 29 | 112 | PF00041 | Fibronectin |
ProfileScan | IPR003961 | 28 | 118 | PS50853 | Fibronectin |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 9 | EVVTVNTLAFPITTPEPLVLVTP | 31 | SECONDARY | 23 | 2 | 137 | VLAGIVATICFLAAAILFSTLAA | 159 | PRIMARY | 23 |
---|
![]() |
Primer_f | CCTCCATCGGTGTATAATCAG |
---|---|
Primer_r | GCATATTTCCTTAGCTCAGCG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CCTCCATCGGTGTATAATCAG |
Primer_r | GCATATTTCCTTAGCTCAGCG |
PCR product length | 157 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |