KIAA1034

Product ID	ORK00718
Accession No	AB028957
Description	SATB homeobox 2, transcript variant 2
Clone name	fh00753
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4999 bp) Predicted protein sequence (761 aa)
HaloTag ORF Clone	FHC00718
Flexi ORF Clone	FXC00718
Source	Human fetal brain
Rouge ID	mKIAA1034 by Kazusa Mouse cDNA Project

Length: 4999 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2711 bp
Genome contig ID	gi89161199r_199742469
PolyA signal sequence (AATAAA,-10)	+--------+--------+----*----+---- TTTGGTTGTTAAAATAAACGCATTCAATAAATATG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTTTGTTTGTCAGTTATTTTACTGGGCATTATCTGCTTTCCCACTTAAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	r	199842469	200033446	11	99.4	Perfect prediction

Length: 761 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92613	100.0	SATB family mem...	Homo sapiens
XP_516012	100.0	SATB family mem...	Pan troglodytes
Q9UPW6	100.0	DNA-binding pro...	Homo sapiens
BAG51771	99.9	unnamed protein...	Homo sapiens
XP_614966	99.5	similar to SATB...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003350	383	465	PF02376	Homeodomain protein CUT
	IPR003350	501	588	PF02376	Homeodomain protein CUT
	IPR001356	643	700	PF00046	Homeobox
HMMSmart	IPR001356	642	705	SM00389	Homeobox
ProfileScan	IPR003350	378	465	PS51042	Homeodomain protein CUT
	IPR003350	501	588	PS51042	Homeodomain protein CUT
	IPR001356	640	701	PS50071	Homeobox

Primer_f	ATGGTTGCTGCTTCCTGATCT
Primer_r	AAGATACCAAATGCGGATGCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-