KIAA1216

Product ID	ORK00201
Accession No	AB033042
Description	mediator complex subunit 23, transcript variant 1
Clone name	fh02294
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone fh02294 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCCC ACGCGTCCG) instead of regular one (GTCGACCCAC GCGTCCG).
cDNA sequence	DNA sequence (5212 bp) Predicted protein sequence (1421 aa)
HaloTag ORF Clone	FHC00201
Flexi ORF Clone	FXC00201
Source	Human fetal brain
Rouge ID	mKIAA1216 by Kazusa Mouse cDNA Project

Length: 5212 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	946 bp
Genome contig ID	gi89161210r_131849566
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- TCTGCTGAATGAATAAACCATGTGATTGTTTCCCG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTCCATTGGAATGAGTGTCGGCTGTGTGCCAGGTGGTGTGCTGGCTGGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	r	131949566	131991041	29	99.8	Perfect prediction

Length: 1421 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_527503	99.4	cofactor requir...	Pan troglodytes
Q9ULK4	100.0	Mediator of RNA...	Homo sapiens
CAI23321	99.5	cofactor requir...	Homo sapiens
EAW48049	99.7	cofactor requir...	Homo sapiens
CAI23320	100.0	cofactor requir...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	1008	YFGNVCLRFLPVFDIVIHRFLEL	1030	PRIMARY	23

Primer_f	ACTTCGTCTTCGATTCATCAC
Primer_r	CTTTCTCCACAGTACAGTCTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-