KIAA1041

Product ID	ORK02015
Accession No	AB028964
Description	forkhead box J3, transcript variant 1
Clone name	fh02801
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5341 bp) Predicted protein sequence (642 aa)
HaloTag ORF Clone	FHC02015
Flexi ORF Clone	FXC02015
Source	Human fetal brain
Rouge ID	mKIAA1041 by Kazusa Mouse cDNA Project

Length: 5341 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3160 bp
Genome contig ID	gi89161185r_42314807
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- AATGGCACTTAAAATAAATATATTATGTTAACTCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTTACAACACTGATTGGTCTCCGTTGTTTGCTGTAATTGAAGAAGTGAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	r	42414807	42573223	15	99.3	Perfect prediction

Length: 642 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9UPW0	7.2e-201	100.0	Forkhead box pr...	Homo sapiens
AAI51829	2.5e-200	99.8	Forkhead box J3...	Homo sapiens
XP_001085783	3.5e-200	99.7	similar to fork...	Macaca mulatta
EAX07162	4.3e-200	99.7	forkhead box J3...	Homo sapiens
XP_001172886	2.5e-195	99.8	forkhead box J3...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001766	101	175	PD000425	Fork head transcription factor
FPrintScan	IPR001766	98	111	PR00053	Fork head transcription factor
	IPR001766	119	136	PR00053	Fork head transcription factor
	IPR001766	142	159	PR00053	Fork head transcription factor
HMMPfam	IPR001766	98	197	PF00250	Fork head transcription factor
HMMSmart	IPR001766	96	186	SM00339	Fork head transcription factor
ProfileScan	IPR001766	98	193	PS50039	Fork head transcription factor
ScanRegExp	IPR001766	98	111	PS00657	Fork head transcription factor
ScanRegExp	IPR001766	142	148	PS00658	Fork head transcription factor

Primer_f	GGCAGCAACAATCCTAATGAC
Primer_r	CCTCTATGATGAACGGCAACC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-