Order Kazusa clone(s) from : ![]() |
Product ID | ORK00770 |
---|---|
Accession No | AB033043 |
Description | KIAA1217, transcript variant 2 |
Clone name | fh03001s1 |
Vector information | |
cDNA sequence | DNA sequence (6127 bp) Predicted protein sequence (1339 aa) |
HaloTag ORF Clone |
FHC00770
![]() |
Flexi ORF Clone | FXC00770 |
Source | Human fetal brain |
Rouge ID |
mKIAA1217
by Kazusa Mouse cDNA Project
|
Note | We replaced fh03001, former representative clones for KIAA1217 with fh03001s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1523 bp |
---|---|
Genome contig ID | gi89161187f_23923681 |
PolyA signal sequence (AATAAA,-23) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (953104 - 953153) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 10 | f | 24023681 | 24876783 | 19 | 99.6 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
None | - | - | - | - | - |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 2 | TALLLHGVFLLLLIFFLEQGK | 22 | PRIMARY | 21 |
---|
![]() |
Primer_f | TCCGTCTCACTGAATCAAGGT |
---|---|
Primer_r | AATGTAACTCCGACTTGTGCC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |