Gene/Protein Characteristic Table for KIAA0849
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK01610
Accession No AB020656
Description cylindromatosis (turban tumor syndrome), transcript variant 2
Clone name fh04363
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5414 bp)
Predicted protein sequence (960 aa)
Flexi ORF Clone FXC01610
Source Human fetal brain
Rouge ID mKIAA0849 by Kazusa Mouse cDNA Project
Note We replaced hk05904, former representative clones for KIAA0849 with fh04363. (2001/5/29)
Features of the cloned cDNA sequence
Description

Length: 5414 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 960 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAF85664 0 99.9 unnamed protein...
Homo sapiens
Q9NQC7 0 99.7 Probable ubiqui...
Homo sapiens
Q5RED8 0 99.3 Probable ubiqui...
Pongo abelii
XP_001489497 0 97.1 cylindromatosis...
Equus caballus
XP_854436 0 96.9 similar to cyli...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000938 134 210 PF01302 CAP-Gly
IPR000938 239 310 PF01302 CAP-Gly
IPR000938 476 544 PF01302 CAP-Gly
ProfileScan IPR000938 160 205 PS50245 CAP-Gly
IPR000938 496 539 PS50245 CAP-Gly
IPR001394 596 955 PS50235 Peptidase C19
ScanRegExp IPR000938 260 293 PS00845 CAP-Gly
IPR001394 597 612 PS00972 Peptidase C19
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f TTATCGAAATGTTAGCAGCAG
Primer_r TCATCTATGGTCCTGGTCTAC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 16
Experimental conditions
Panel name GeneBridge 4
Primer_f TTATCGAAATGTTAGCAGCAG
Primer_r TCATCTATGGTCCTGGTCTAC
PCR product length 130 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp