KIAA1784

Product ID	ORK05711
Accession No	AB058687
Description	SLX4 structure-specific endonuclease subunit
Clone name	fh08226
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5027 bp) Predicted protein sequence (1167 aa)
Source	Human fetal brain
Rouge ID	mKIAA1784 by Kazusa Mouse cDNA Project

Length: 5027 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1521 bp
Genome contig ID	gi51511732r_3471220
PolyA signal sequence (AATACA,-20)	+--------+--------+----*----+---- TCCTCGTCTGTTTCAAATACAGTGCAGTCAGTTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATATGATGTGCAATAAACCAAAAAGGCTTTATTAAAATCTGGCTGCCACA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	r	3571220	3584602	7	99.2	Both No-hit

Length: 1167 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW85346	99.7	BTB (POZ) domai...	Homo sapiens
EAW85345	99.7	BTB (POZ) domai...	Homo sapiens
EAW85347	99.7	BTB (POZ) domai...	Homo sapiens
Q8IY92	99.7	BTB/POZ domain-...	Homo sapiens
XP_001167578	98.1	BTB (POZ) domai...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013069	14	127	PF00651	BTB/POZ
HMMSmart	IPR000210	24	127	SM00225	BTB/POZ-like
ProfileScan	IPR000210	24	97	PS50097	BTB/POZ-like

Primer_f	GTCATTGTTACCAGCAGTCTC
Primer_r	ACAGACGAGGACATTCACAAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-