KIAA1234

Product ID	ORK00775
Accession No	AB033060
Description	aryl-hydrocarbon receptor repressor, transcript variant 1
Clone name	fh08618
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5726 bp) Predicted protein sequence (727 aa)
HaloTag ORF Clone	FHC00775
Flexi ORF Clone	FXC00775
Source	Human fetal brain
Rouge ID	mKIAA1234 by Kazusa Mouse cDNA Project

Length: 5726 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3521 bp
Genome contig ID	gi51511721f_257291
PolyA signal sequence (AATACA,-29)	+--------+--------+----*----+---- ATGTAAAATACATGACATGCTAGTACATGTTTAAC
Flanking genome sequence	None

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	f	357289	499796	14	99.1	Both No-hit

Length: 727 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW50992	100.0	hCG2044128 [Hom...	Homo sapiens
AAI60162	99.9	Aryl-hydrocarbo...	synthetic construct
EAW50995	100.0	hCG1985585, iso...	Homo sapiens
AAG33381	99.9	dioxin receptor...	Homo sapiens
EAW50998	100.0	hCG1985585, iso...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001092	46	90	PF00010	Basic helix-loop-helix dimerisation region bHLH
HMMPfam	IPR013767	122	187	PF00989	PAS fold
HMMSmart	IPR001092	43	97	SM00353	Basic helix-loop-helix dimerisation region bHLH
HMMSmart	IPR000014	122	188	SM00091	PAS
ProfileScan	IPR001092	25	90	PS50888	Basic helix-loop-helix dimerisation region bHLH
ProfileScan	IPR000014	125	190	PS50112	PAS

Primer_f	CAGATTGAGTGGTGGGTTGCT
Primer_r	GGGAGTTTTTGTTGCCGTTGA
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CAGATTGAGTGGTGGGTTGCT
Primer_r	GGGAGTTTTTGTTGCCGTTGA
PCR product length	177 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles