Gene/Protein Characteristic Table for KIAA1835
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00930
Accession No AB058738
Description Ran GTPase activating protein 1, transcript variant 2
Clone name fh08795s1
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4240 bp)
Predicted protein sequence (623 aa)
Flexi ORF Clone FXC00930
Source Human fetal brain
Rouge ID mKIAA1835 by Kazusa Mouse cDNA Project
Note We replaced fh08795, former representative clones for KIAA1835 with fh08795s1. (2002/5/10)
Features of the cloned cDNA sequence
Description

Length: 4240 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 623 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAW60420 1.4e-188 100.0 Ran GTPase acti...
Homo sapiens
XP_515261 1.3e-186 98.7 hypothetical pr...
Pan troglodytes
P46060 2.1e-184 100.0 Ran GTPase-acti...
Homo sapiens
EAW60421 8.8e-184 99.8 Ran GTPase acti...
Homo sapiens
BAB69728 1.5e-183 94.2 hypothetical pr...
Macaca fascicularis
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR001611 150 163 PR00019 Leucine-rich repeat
IPR001611 356 369 PR00019 Leucine-rich repeat
HMMPfam IPR001611 149 171 PF00560 Leucine-rich repeat
IPR001611 358 384 PF00560 Leucine-rich repeat
IPR009109 440 622 PF07834 Ran-GTPase activating protein 1
HMMSmart IPR003590 84 111 SM00368 Leucine-rich repeat
IPR003590 147 174 SM00368 Leucine-rich repeat
IPR003590 177 204 SM00368 Leucine-rich repeat
IPR003590 215 242 SM00368 Leucine-rich repeat
IPR003590 243 270 SM00368 Leucine-rich repeat
IPR003590 271 298 SM00368 Leucine-rich repeat
IPR003590 299 326 SM00368 Leucine-rich repeat
IPR003590 328 355 SM00368 Leucine-rich repeat
IPR003590 356 383 SM00368 Leucine-rich repeat
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f CTTACTGCAACTTTGGCCTCC
Primer_r GCTGTCAAAGTCTTCAATCTC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 22
Experimental conditions
Panel name unigene
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp