KIAA1238

Product ID	ORK00204
Accession No	AB033064
Description	ribosomal modification protein rimK-like family member B, transcript variant 1
Clone name	fh09938
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5393 bp) Predicted protein sequence (408 aa)
HaloTag ORF Clone	FHC00204
Flexi ORF Clone	FXC00204
Source	Human fetal brain
Rouge ID	mKIAA1238 by Kazusa Mouse cDNA Project

Length: 5393 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3407 bp
Genome contig ID	gi89161190f_8643709
PolyA signal sequence (AATATA,-25)	+--------+--------+----*----+---- TAAAAAATGTAATATATTGCAGGATTTATAACCAG
Flanking genome sequence (177346 - 177395)	----+--------+--------+--------+--------+----* GTTCACTGACTGCTTGCTTGCTTTCTTTTTTTTTTTTTTTTTTTTTTTTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	f	8743709	8821053	6	99.3	Perfect prediction

Length: 408 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001118430	7.5e-170	99.8	hypothetical pr...	Macaca mulatta
XP_543825	1e-163	98.7	hypothetical pr...	Canis lupus fam...
XP_001916098	2.1e-162	99.7	hypothetical pr...	Equus caballus
XP_001927870	3.9e-162	99.2	hypothetical pr...	Sus scrofa
Q0VCE9	7.3e-161	98.4	Ribosomal prote...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013651	134	325	PF08443	ATP-grasp fold
HMMTigr	IPR004666	30	325	TIGR00768	S6 modification enzyme RimK
ProfileScan	IPR011761	141	326	PS50975	ATP-grasp fold

Primer_f	GTGTTATACTTTTCTCCTGGC
Primer_r	GTTACCTGTCTGAGCACCTAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GTGTTATACTTTTCTCCTGGC
Primer_r	GTTACCTGTCTGAGCACCTAC
PCR product length	107 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles