KIAA1240

Product ID	ORK04197
Accession No	AB033066
Description	ATPase family, AAA domain containing 2B
Clone name	fh10357
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5579 bp) Predicted protein sequence (733 aa)
Source	Human fetal brain
Rouge ID	mKIAA1240 by Kazusa Mouse cDNA Project

Length: 5579 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3375 bp
Genome contig ID	gi89161199r_23725045
PolyA signal sequence (AATAAA,-15)	+--------+--------+----*----+---- TAACTGCTGTGAAATACTTGAATAAAGATGACAAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAACATGTCTTTCTTTAGCTTAATTATGATCACTGTTGGCTACAAATG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	r	23825045	23896229	12	100.0	Perfect prediction

Length: 733 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9ULI0	99.3	ATPase family A...	Homo sapiens
NP_060022	99.3	ATPase family, ...	Homo sapiens
XP_001501559	95.7	similar to ATPa...	Equus caballus
XP_596986	96.2	similar to ATPa...	Bos taurus
XP_858149	95.0	similar to ATPa...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033112	0.00092	33.9	KIAA1286

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001487	267	283	PR00503	Bromodomain
	IPR001487	283	301	PR00503	Bromodomain
	IPR001487	301	320	PR00503	Bromodomain
HMMPfam	IPR001487	240	325	PF00439	Bromodomain
HMMSmart	IPR001487	236	343	SM00297	Bromodomain
ProfileScan	IPR001487	238	313	PS50014	Bromodomain
ScanRegExp	IPR001487	260	312	PS00633	Bromodomain

Primer_f	ATGGCTGTGGAGTTAATTGTG
Primer_r	GGACCTGACACTGAAGATACC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TCTTTGGCTCTTTGTAGTGTG
Primer_r	GAAACTTCACAGACTAGGTAC
PCR product length	164 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles