Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK05645 |
---|---|
Accession No | AB033067 |
Description | B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB |
Clone name | fh10384 |
Vector information | |
cDNA sequence | DNA sequence (5755 bp) Predicted protein sequence (863 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1241
by Kazusa Mouse cDNA Project
|
Note | Please refer to "Gene/Protein Characteristic Table for KIAA1689" because the cDNA sequence of KIAA1241 is included in KIAA1689. |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
None | - | - | - | - | - |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 1 | KIIIKYISLGILFSLKYFLFFSN | 23 | PRIMARY | 23 |
---|
RT-PCR-ELISA |
Primer_f | CTTCAGATTTGCCTTCATTCG |
---|---|
Primer_r | GGAAGCGACCTCTCAACATTG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CTTCAGATTTGCCTTCATTCG |
Primer_r | GGAAGCGACCTCTCAACATTG |
PCR product length | 159(2k) bp |
PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |