KIAA1689

Product ID	ORK01694
Accession No	AB051476
Description	B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB
Clone name	bg00184s4
Vector information	The cDNA fragment was originally inserted at SalI-NotI site ... The cDNA fragment was originally inserted at SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR) and DNA fragments (1-4981) were subcloned upstream of the cDNA (4982-10819). The adjacent sequence to the 5' end of the cDNA is as follows: GGGCCCCCCC TCGAG-5' end of cDNA
cDNA sequence	DNA sequence (10819 bp) Predicted protein sequence (2627 aa)
Flexi ORF Clone	FXC01694
Source	Human adult brain
Note	We replaced fh26762 and bg00184, former representative clones for KIAA1689 with bg00184s4. (2002/5/10,2003/8/28)

Length: 10819 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2934 bp
Genome contig ID	gi51511721f_70687451
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TATATAAATTATGTAAATAAAAGTTATTTTATATC
Flanking genome sequence (211953 - 212002)	----+--------+--------+--------+--------+----* ATTTCTGTTGTGTCCTTTTAAGATGACTAAATAAAGAATTGGCTGGGTAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	f	70787451	70899402	39	99.8	Perfect prediction

Length: 2627 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI46793	100.0	B double prime ...	Homo sapiens
A6H8Y1	99.9	Transcription f...	Homo sapiens
AAI61615	100.0	BDP1 protein [H...	Homo sapiens
EAW95689	99.8	B double prime ...	Homo sapiens
NP_060899	99.8	transcription f...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033067	5.2e-168	96.8	KIAA1241
AB020652	0.00033	20.6	KIAA0845

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR014778	303	348	PF00249	Myb
HMMSmart	IPR001005	302	350	SM00717	SANT
ScanRegExp	IPR000977	347	355	PS00697	ATP-dependent DNA ligase

Primer_f	TAGCTTGGGAGTTAGATTGCC
Primer_r	AGGATACTTTAGCTGGCTGAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-