KIAA1944

Product ID	ORK07144
Accession No	AB075824
Description	transmembrane protein 132D
Clone name	fh11215
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5305 bp) Predicted protein sequence (657 aa)
Source	Human fetal brain

Length: 5305 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2150 bp
Genome contig ID	gi89161190r_128022223
PolyA signal sequence (TATAAA,-23)	+--------+--------+----*----+---- ACTGACTGTAAATATAAAGTTTGCATTCAGTGGCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TTATGGCTGTCCTTTGTCTTCTACACGCTGACCCCCTCCAAGGGGCTGGC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	r	128122223	128136498	4	99.4	Perfect prediction

Length: 657 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW98500	100.0	transmembrane p...	Homo sapiens
Q14C87	99.8	Transmembrane p...	Homo sapiens
BAC97794	99.7	HBE120 [Homo sa...	Homo sapiens
AAI14627	99.7	TMEM132D protei...	Homo sapiens
XP_001107847	97.9	similar to CG14...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB067493	1.8e-71	52.5	KIAA1906

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	478	MYALLGVFCLAILVFLINCVTFA	500	PRIMARY	23

Primer_f	ACGGAGCTGATAAATGACTTC
Primer_r	GTCTTTTCAGCGAGGATGGTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-