Gene/Protein Characteristic Table for KIAA1313
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK06288
Accession No AB037734
Description protocadherin 19
Clone name fh12154
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5818 bp)
Predicted protein sequence (398 aa)
Source Human fetal brain
Rouge ID mKIAA1313 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 5818 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 4621 bp
Genome contig ID gi89161218r_99333300
PolyA signal sequence
(ATTAAA,-23)
+----*----+----*----+----*----+----
ATGCATTTTAGTATTAAAGGCTATTATGGAAAAAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TATTGAGTGTTTGGTGGAATGTGTTTCAGAGAGTGTTTGTAGGCTCGCGG
Features of the protein sequence
Description

Length: 398 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
CAI41393 3.1e-161 100.0 protocadherin 1...
Homo sapiens
EAX02805 4.5e-161 100.0 protocadherin 1...
Homo sapiens
BAG10449 4.9e-161 100.0 protocadherin-1...
synthetic construct
NP_065817 5.9e-160 99.7 protocadherin 1...
Homo sapiens
CAH18133 7.7e-160 99.5 hypothetical pr...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB046782 1.3e-07 26.9 KIAA1562
AB037821 4.5e-05 29.6 KIAA1400
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f TTTAATGACCAAGAGCCAGAC
Primer_r TAGTGTCATCAGGCTCATTCC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. X
Experimental conditions
Panel name GeneBridge 4
Primer_f ATGTCAACAATGGCCCTACTC
Primer_r CTTCAGACGCTTCACACCAGG
PCR product length 134 bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp