Order Kazusa clone(s) from : ![]() |
Product ID | ORK05408 |
---|---|
Accession No | AB037737 |
Description | HEAT repeat containing 5A |
Clone name | fh12964 |
Vector information | |
cDNA sequence | DNA sequence (5477 bp) Predicted protein sequence (1590 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1316
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 703 bp |
---|---|
Genome contig ID | gi51511730r_30731838 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (99721 - 99672) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 14 | r | 30831559 | 30922706 | 27 | 99.7 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000357 | 395 | 431 | PF02985 | HEAT |
IPR000357 | 477 | 514 | PF02985 | HEAT |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 4 | HPSISVRLAAAWCLHCIAVALPS | 26 | PRIMARY | 23 | 2 | 47 | EAVTGFSFAVAALLGAVKHCPLG | 69 | SECONDARY | 23 | 3 | 109 | ALMTLGPAVVSHHLARVLLLWKC | 131 | SECONDARY | 23 |
---|
![]() |
Primer_f | CTCATGCAAATTGGACCTCAG |
---|---|
Primer_r | TTGACACTTTCCTGATTGCCC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CTCATGCAAATTGGACCTCAG |
Primer_r | TTGACACTTTCCTGATTGCCC |
PCR product length | 113 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |