KIAA1822

Product ID	ORK05420
Accession No	AB058725
Description	HHIP-like 1
Clone name	fh13781
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5399 bp) Predicted protein sequence (533 aa)
Source	Human fetal brain
Rouge ID	mKIAA1822 by Kazusa Mouse cDNA Project

Length: 5399 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3795 bp
Genome contig ID	gi51511730f_99088804
PolyA signal sequence (None)	+--------+--------+----*----+---- TAGCCCACTTACCATGCATAACAGACAAGTCCCAT
Flanking genome sequence	None

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	f	99188804	99215470	8	99.2	Terminal No-hit

Length: 533 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q96JK4	1.9e-183	100.0	HHIP-like prote...	Homo sapiens
BAE28276	1.1e-153	83.0	unnamed protein...	Mus musculus
Q14DK5	1.2e-153	83.0	HHIP-like prote...	Mus musculus
AAI13774	1.2e-153	83.0	Hedgehog intera...	Mus musculus
EDL18717	1.7e-153	82.8	mCG18356 [Mus m...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001190	426	442	PR00258	Speract/scavenger receptor
	IPR001190	445	456	PR00258	Speract/scavenger receptor
	IPR001190	460	470	PR00258	Speract/scavenger receptor
	IPR001190	492	506	PR00258	Speract/scavenger receptor
	IPR001190	515	527	PR00258	Speract/scavenger receptor
HMMPfam	IPR001190	429	527	PF00530	Speract/scavenger receptor
HMMSmart	IPR001190	424	527	SM00202	Speract/scavenger receptor
ProfileScan	IPR001190	424	527	PS50287	Speract/scavenger receptor
ScanRegExp	IPR001190	431	468	PS00420	Speract/scavenger receptor

Primer_f	GGTGATGCTGTGCCAAGTTCT
Primer_r	TCCAAGACAGTGACCTAAAGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-