KIAA1323

Product ID	ORK05981
Accession No	AB037744
Description	mindbomb E3 ubiquitin protein ligase 1
Clone name	fh13878
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5356 bp) Predicted protein sequence (396 aa)
Source	Human fetal brain
Rouge ID	mKIAA1323 by Kazusa Mouse cDNA Project

Length: 5356 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	4164 bp
Genome contig ID	gi51511735f_17572324
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- GTACTTCTTTAAAACATTAAATTTGAGGAAACTTT
Flanking genome sequence (130454 - 130503)	----+--------+--------+--------+--------+----* AATGCTGTCTCGTGTACATTGCTTTACTACAGTGAGGGGGAATATCCTTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	18	f	17672324	17702776	10	99.5	Internal No-hit

Length: 396 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG52320	2.5e-157	100.0	unnamed protein...	Homo sapiens
CAH18429	2.5e-157	100.0	hypothetical pr...	Homo sapiens
EAX01132	2.7e-157	100.0	mindbomb homolo...	Homo sapiens
AAN18023	2.9e-157	100.0	MINDBOMB; ubiqu...	Homo sapiens
XP_001092086	2.9e-157	100.0	similar to mind...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023174	2.5e-07	32.0	KIAA0957
AB058779	0.00053	26.0	KIAA1876

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002110	22	34	PR01415	Ankyrin
FPrintScan	IPR002110	68	80	PR01415	Ankyrin
HMMPfam	IPR002110	21	54	PF00023	Ankyrin
	IPR002110	55	87	PF00023	Ankyrin
	IPR002110	88	161	PF00023	Ankyrin
	IPR001841	353	385	PF00097	Zinc finger
HMMSmart	IPR002110	21	51	SM00248	Ankyrin
	IPR002110	55	84	SM00248	Ankyrin
	IPR002110	88	119	SM00248	Ankyrin
	IPR001841	209	243	SM00184	Zinc finger
	IPR001841	256	290	SM00184	Zinc finger
	IPR001841	353	385	SM00184	Zinc finger
ProfileScan	IPR002110	21	45	PS50088	Ankyrin
	IPR002110	21	169	PS50297	Ankyrin
	IPR002110	55	87	PS50088	Ankyrin
	IPR001841	209	244	PS50089	Zinc finger
	IPR001841	256	291	PS50089	Zinc finger
	IPR001841	353	386	PS50089	Zinc finger

Primer_f	AATTGCTGTTTGTCCACTCTG
Primer_r	TCTGTTGTAACCCCACTGTCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AATTGCTGTTTGTCCACTCTG
Primer_r	TCTGTTGTAACCCCACTGTCC
PCR product length	120 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles