KIAA1324

Product ID	ORK05652
Accession No	AB037745
Description	KIAA1324
Clone name	fh14139
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5567 bp) Predicted protein sequence (580 aa)
Source	Human fetal brain
Rouge ID	mKIAA1324 by Kazusa Mouse cDNA Project

Length: 5567 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3823 bp
Genome contig ID	gi89161185f_109433263
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- CTTTTTTTTTTTTGTAAAATAAAAACATACCTTAC
Flanking genome sequence (117663 - 117712)	----+--------+--------+--------+--------+----* AAGTTGTTTTTCTTAAACATGGGTTGGGTGGCTGGAGGGGTGAGTGGGAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	109533263	109550924	14	99.1	Internal No-hit

Length: 580 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG59704	99.8	unnamed protein...	Homo sapiens
AAQ88732	100.0	AEPG2426 [Homo ...	Homo sapiens
BAG63086	99.6	unnamed protein...	Homo sapiens
NP_065826	99.6	hypothetical pr...	Homo sapiens
BAG59899	99.5	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	TTACCTTGAGTCCTGGAACAC
Primer_r	CCTACTGCTTGAATACACCAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 1

Experimental conditions

Panel name	GeneBridge 4
Primer_f	TTACCTTGAGTCCTGGAACAC
Primer_r	CCTACTGCTTGAATACACCAC
PCR product length	101 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles