Order Kazusa clone(s) from : ![]() |
Product ID | ORK04049 |
---|---|
Accession No | AB075825 |
Description | antizyme inhibitor 2 |
Clone name | fh14407 |
Vector information | |
cDNA sequence | DNA sequence (5848 bp) Predicted protein sequence (420 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1945
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 2410 bp |
---|---|
Genome contig ID | gi89161185f_33219959 |
PolyA signal sequence (AATAAA,-28) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (138761 - 138810) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | f | 33319847 | 33358718 | 7 | 99.6 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR002433 | 44 | 68 | PR01182 | Ornithine decarboxylase |
IPR002433 | 70 | 97 | PR01182 | Ornithine decarboxylase | |
IPR000183 | 72 | 90 | PR01179 | Orn/DAP/Arg decarboxylase 2 | |
IPR000183 | 92 | 104 | PR01179 | Orn/DAP/Arg decarboxylase 2 | |
IPR002433 | 114 | 138 | PR01182 | Ornithine decarboxylase | |
IPR002433 | 144 | 166 | PR01182 | Ornithine decarboxylase | |
IPR000183 | 194 | 207 | PR01179 | Orn/DAP/Arg decarboxylase 2 | |
IPR000183 | 277 | 296 | PR01179 | Orn/DAP/Arg decarboxylase 2 | |
IPR002433 | 326 | 339 | PR01182 | Ornithine decarboxylase | |
IPR002433 | 360 | 370 | PR01182 | Ornithine decarboxylase | |
IPR002433 | 380 | 393 | PR01182 | Ornithine decarboxylase | |
IPR000183 | 393 | 406 | PR01179 | Orn/DAP/Arg decarboxylase 2 | |
HMMPfam | IPR000183 | 50 | 288 | PF02784 | Orn/DAP/Arg decarboxylase 2 |
IPR000183 | 291 | 414 | PF00278 | Orn/DAP/Arg decarboxylase 2 | |
ScanRegExp | IPR000183 | 72 | 90 | PS00878 | Orn/DAP/Arg decarboxylase 2 |
IPR000183 | 228 | 245 | PS00879 | Orn/DAP/Arg decarboxylase 2 |
![]() |
Primer_f | ACCTCCAAGACCATCGTGTAC |
---|---|
Primer_r | ACGCAATCACAGCCATCAACC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |