Order Kazusa clone(s) from : ![]() |
Product ID | ORK05002 |
---|---|
Accession No | AB037753 |
Description | F-box protein 42 |
Clone name | fh15405 |
Vector information | |
cDNA sequence | DNA sequence (5788 bp) Predicted protein sequence (651 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1332
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 3831 bp |
---|---|
Genome contig ID | gi89161185r_16345921 |
PolyA signal sequence (AATAAA,-24) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | r | 16445921 | 16514303 | 9 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | TTCACAGGTTATACAGCAGAG |
---|---|
Primer_r | TCAAATCAATCCACAGACAGC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |