Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK05526 |
---|---|
Accession No | AB028946 |
Description | IQ motif containing E |
Clone name | fh15455 |
Vector information | |
cDNA sequence | DNA sequence (5581 bp) Predicted protein sequence (666 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1023
by Kazusa Mouse cDNA Project
|
Note | We replaced fg00777, former representative clones for KIAA1023 with fh15455. (2001/5/29) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 3580 bp |
---|---|
Genome contig ID | gi89161213f_2475117 |
PolyA signal sequence (AATAAA,-18) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (145767 - 145816) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 7 | f | 2575117 | 2620882 | 21 | 98.9 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000048 | 514 | 534 | PF00612 | IQ calmodulin-binding region |
IPR000048 | 573 | 593 | PF00612 | IQ calmodulin-binding region | |
HMMSmart | IPR000048 | 512 | 534 | SM00015 | IQ calmodulin-binding region |
IPR000048 | 571 | 593 | SM00015 | IQ calmodulin-binding region | |
ProfileScan | IPR000048 | 513 | 542 | PS50096 | IQ calmodulin-binding region |
IPR000048 | 572 | 601 | PS50096 | IQ calmodulin-binding region |
RT-PCR-ELISA |
Primer_f | CCACTTAGCTTCTGTTTCTGC |
---|---|
Primer_r | TCAGTTACACAGTCCATCAAG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |