KIAA1023

Product ID	ORK05526
Accession No	AB028946
Description	IQ motif containing E
Clone name	fh15455
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5581 bp) Predicted protein sequence (666 aa)
Source	Human fetal brain
Rouge ID	mKIAA1023 by Kazusa Mouse cDNA Project
Note	We replaced fg00777, former representative clones for KIAA1023 with fh15455. (2001/5/29)

Length: 5581 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3580 bp
Genome contig ID	gi89161213f_2475117
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TCATTATTGGCCTTTTAAATAAAAAGTTGTTTTGC
Flanking genome sequence (145767 - 145816)	----+--------+--------+--------+--------+----* AGTGTGCCTTGAGTGCCCCGTGAAGACTTCTCTTTAATGACCTCCAGGTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	f	2575117	2620882	21	98.9	Perfect prediction

Length: 666 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW87261	6.8e-211	99.7	IQ motif contai...	Homo sapiens
Q6IPM2	6.9e-211	99.7	IQ domain-conta...	Homo sapiens
AAH71858	4.9e-210	99.4	IQ motif contai...	Homo sapiens
XP_518939	3.5e-205	97.7	IQ motif contai...	Pan troglodytes
EAW87262	1.7e-198	99.7	IQ motif contai...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000048	514	534	PF00612	IQ calmodulin-binding region
HMMPfam	IPR000048	573	593	PF00612	IQ calmodulin-binding region
HMMSmart	IPR000048	512	534	SM00015	IQ calmodulin-binding region
HMMSmart	IPR000048	571	593	SM00015	IQ calmodulin-binding region
ProfileScan	IPR000048	513	542	PS50096	IQ calmodulin-binding region
ProfileScan	IPR000048	572	601	PS50096	IQ calmodulin-binding region

Primer_f	CCACTTAGCTTCTGTTTCTGC
Primer_r	TCAGTTACACAGTCCATCAAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-