Order Kazusa clone(s) from : ![]() |
Product ID | ORK02056 |
---|---|
Accession No | AB058727 |
Description | DDB1 and CUL4 associated factor 5, transcript variant 1 |
Clone name | fh17057 |
Vector information | |
cDNA sequence | DNA sequence (5814 bp) Predicted protein sequence (958 aa) |
HaloTag ORF Clone |
FHC02056
![]() |
Flexi ORF Clone | FXC02056 |
Source | Human fetal brain |
Rouge ID |
mKIAA1824
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 2931 bp |
---|---|
Genome contig ID | gi51511730r_68487395 |
PolyA signal sequence (AATAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 14 | r | 68587395 | 68689502 | 9 | 99.2 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR001680 | 65 | 99 | PD000018 | WD40 repeat |
IPR001680 | 157 | 188 | PD000018 | WD40 repeat | |
FPrintScan | IPR001680 | 85 | 99 | PR00320 | WD40 repeat |
IPR001680 | 174 | 188 | PR00320 | WD40 repeat | |
IPR001680 | 311 | 325 | PR00320 | WD40 repeat | |
HMMPfam | IPR001680 | 59 | 98 | PF00400 | WD40 repeat |
IPR001680 | 107 | 145 | PF00400 | WD40 repeat | |
IPR001680 | 148 | 187 | PF00400 | WD40 repeat | |
IPR001680 | 300 | 324 | PF00400 | WD40 repeat | |
IPR001680 | 339 | 377 | PF00400 | WD40 repeat | |
HMMSmart | IPR001680 | 58 | 98 | SM00320 | WD40 repeat |
IPR001680 | 106 | 145 | SM00320 | WD40 repeat | |
IPR001680 | 148 | 187 | SM00320 | WD40 repeat | |
IPR001680 | 195 | 232 | SM00320 | WD40 repeat | |
IPR001680 | 280 | 324 | SM00320 | WD40 repeat | |
IPR001680 | 338 | 377 | SM00320 | WD40 repeat | |
ProfileScan | IPR001680 | 65 | 107 | PS50082 | WD40 repeat |
IPR001680 | 65 | 377 | PS50294 | WD40 repeat | |
IPR001680 | 154 | 189 | PS50082 | WD40 repeat | |
IPR001680 | 345 | 377 | PS50082 | WD40 repeat |
![]() |
Primer_f | CTTAGTGAGGAGCAGAATGTG |
---|---|
Primer_r | CTGTTACCTTGAGATGCCTAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |