KIAA1461

Product ID	ORK05942
Accession No	AB040894
Description	methyl-CpG binding domain protein 5
Clone name	fh17578
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5285 bp) Predicted protein sequence (1498 aa)
Source	Human fetal brain
Rouge ID	mKIAA1461 by Kazusa Mouse cDNA Project

Length: 5285 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	510 bp
Genome contig ID	gi89161199f_148832508
PolyA signal sequence (AATAAA,-16)	+--------+--------+----*----+---- CTACCAGTGTAAAGTGATAAATAAAAATACAACCT
Flanking genome sequence (154984 - 155033)	----+--------+--------+--------+--------+----* AAATGCTTTTCTATGATAATGTAAAAGATGCTGTTTTTGTATTTAACAGC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	f	148932508	148987490	10	99.7	Perfect prediction

Length: 1498 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9P267	100.0	Methyl-CpG-bind...	Homo sapiens
EAX11552	99.9	methyl-CpG bind...	Homo sapiens
XP_541030	97.1	similar to meth...	Canis lupus fam...
XP_001488025	96.9	methyl-CpG bind...	Equus caballus
XP_001787441	96.1	similar to meth...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB067474	1.7e-07	28.1	KIAA1887

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001739	25	88	PF01429	Methyl-CpG binding
HMMPfam	IPR000313	1386	1449	PF00855	PWWP
HMMSmart	IPR001739	15	92	SM00391	Methyl-CpG binding
ProfileScan	IPR001739	15	85	PS50982	Methyl-CpG binding
ProfileScan	IPR000313	1389	1413	PS50812	PWWP

Primer_f	GCCAATCAAAGTCTCTGTGTG
Primer_r	AGTGTGCATTAGGTACGCTTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GCCAATCAAAGTCTCTGTGTG
Primer_r	AGTGTGCATTAGGTACGCTTG
PCR product length	215 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles