KIAA1946

Product ID	ORK05731
Accession No	AB075826
Description	family with sequence similarity 171, member B
Clone name	fh17936
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5175 bp) Predicted protein sequence (679 aa)
Source	Human fetal brain

Length: 5175 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3133 bp
Genome contig ID	gi89161199f_187216455
PolyA signal sequence (AATAAA,-16)	+--------+--------+----*----+---- AGTTCATTAAAAATAATAAAATAAATCTAAAATGT
Flanking genome sequence (122477 - 122526)	----+--------+--------+--------+--------+----* ACTTGGAGCATTGTTTAATTTTTGGTGAACTAGAAAACATTCCTCCCTAC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	f	187313401	187338930	7	99.1	Perfect prediction

Length: 679 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q6P995	100.0	Protein FAM171B...	Homo sapiens
AAH60872	99.9	Family with seq...	Homo sapiens
BAC35021	89.0	unnamed protein...	Mus musculus
Q14CH0	89.0	Protein FAM171B...	Mus musculus
AAI13788	89.0	D430039N05Rik p...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	207	VFLTAILGGTIVIVIGFFAVLLC	229	PRIMARY	23

Primer_f	AGACCTAAGCAGCAGTGAGAG
Primer_r	TTCAACAGTGCTTTTCCTTCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-