Gene/Protein Characteristic Table for KIAA1556
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK05676
Accession No AB046776
Description obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Clone name fh18619
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4789 bp)
Predicted protein sequence (1595 aa)
Source Human fetal brain
Features of the cloned cDNA sequence
Description

Length: 4789 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 0 bp
Genome contig ID gi89161185f_226436256
PolyA signal sequence
(None)		 
+----*----+----*----+----*----+----
AGTCCAGCCTGGACAGCAAAGCTAGACTTCATCTC
Flanking genome sequence None

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 1 f 226535097 226606965 20 99.5 Terminal No-hit
Features of the protein sequence
Description

Length: 1595 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
CAC85752 0 98.5 obscurin [Homo ...
 Homo sapiens
CAH71673 0 82.9 obscurin, cytos...
 Homo sapiens
NP_443075 0 82.9 obscurin, cytos...
 Homo sapiens
NP_001092093 0 82.9 obscurin, cytos...
 Homo sapiens
Q5VST9 0 82.9 Obscurin; Obscu...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB014557 7.7e-18 26.5 KIAA0657
D86983 7.8e-12 26.6 KIAA0230
AB040929 1.3e-11 25.0 KIAA1496
AB037718 1.3e-08 23.8 KIAA1297
AB032958 2e-08 23.4 KIAA1132
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR013098 11 97 PF07679 Immunoglobulin I-set
IPR013098 102 186 PF07679 Immunoglobulin I-set
IPR013098 191 275 PF07679 Immunoglobulin I-set
IPR013151 294 350 PF00047 Immunoglobulin
IPR013098 371 455 PF07679 Immunoglobulin I-set
IPR013098 460 544 PF07679 Immunoglobulin I-set
IPR013098 549 632 PF07679 Immunoglobulin I-set
IPR013098 637 720 PF07679 Immunoglobulin I-set
IPR013098 725 808 PF07679 Immunoglobulin I-set
IPR013098 813 896 PF07679 Immunoglobulin I-set
IPR013151 915 973 PF00047 Immunoglobulin
IPR013098 989 1072 PF07679 Immunoglobulin I-set
IPR013098 1077 1160 PF07679 Immunoglobulin I-set
IPR013098 1165 1248 PF07679 Immunoglobulin I-set
IPR013098 1253 1336 PF07679 Immunoglobulin I-set
IPR013098 1341 1424 PF07679 Immunoglobulin I-set
IPR013098 1429 1512 PF07679 Immunoglobulin I-set
HMMSmart IPR003599 17 98 SM00409 Immunoglobulin subtype
IPR003599 108 187 SM00409 Immunoglobulin subtype
IPR003598 114 180 SM00408 Immunoglobulin subtype 2
IPR003599 197 276 SM00409 Immunoglobulin subtype
IPR003598 203 269 SM00408 Immunoglobulin subtype 2
IPR003599 286 367 SM00409 Immunoglobulin subtype
IPR003598 292 360 SM00408 Immunoglobulin subtype 2
IPR003599 377 458 SM00409 Immunoglobulin subtype
IPR003598 383 449 SM00408 Immunoglobulin subtype 2
IPR003599 466 545 SM00409 Immunoglobulin subtype
IPR003598 472 538 SM00408 Immunoglobulin subtype 2
IPR003599 555 633 SM00409 Immunoglobulin subtype
IPR003598 561 626 SM00408 Immunoglobulin subtype 2
IPR003599 643 721 SM00409 Immunoglobulin subtype
IPR003598 649 714 SM00408 Immunoglobulin subtype 2
IPR003599 731 809 SM00409 Immunoglobulin subtype
IPR003598 737 802 SM00408 Immunoglobulin subtype 2
IPR003599 819 897 SM00409 Immunoglobulin subtype
IPR003598 825 890 SM00408 Immunoglobulin subtype 2
IPR003599 907 985 SM00409 Immunoglobulin subtype
IPR003598 913 978 SM00408 Immunoglobulin subtype 2
IPR003599 995 1073 SM00409 Immunoglobulin subtype
IPR003598 1001 1066 SM00408 Immunoglobulin subtype 2
IPR003599 1083 1161 SM00409 Immunoglobulin subtype
IPR003598 1089 1154 SM00408 Immunoglobulin subtype 2
IPR003599 1171 1249 SM00409 Immunoglobulin subtype
IPR003598 1177 1242 SM00408 Immunoglobulin subtype 2
IPR003599 1259 1337 SM00409 Immunoglobulin subtype
IPR003598 1265 1330 SM00408 Immunoglobulin subtype 2
IPR003599 1347 1425 SM00409 Immunoglobulin subtype
IPR003598 1353 1418 SM00408 Immunoglobulin subtype 2
IPR003599 1435 1513 SM00409 Immunoglobulin subtype
IPR003598 1441 1506 SM00408 Immunoglobulin subtype 2
ProfileScan IPR007110 101 183 PS50835 Immunoglobulin-like
IPR007110 195 274 PS50835 Immunoglobulin-like
IPR007110 370 444 PS50835 Immunoglobulin-like
IPR007110 459 543 PS50835 Immunoglobulin-like
IPR007110 548 631 PS50835 Immunoglobulin-like
IPR007110 634 719 PS50835 Immunoglobulin-like
IPR007110 724 807 PS50835 Immunoglobulin-like
IPR007110 812 895 PS50835 Immunoglobulin-like
IPR007110 900 983 PS50835 Immunoglobulin-like
IPR007110 988 1071 PS50835 Immunoglobulin-like
IPR007110 1076 1159 PS50835 Immunoglobulin-like
IPR007110 1164 1247 PS50835 Immunoglobulin-like
IPR007110 1252 1335 PS50835 Immunoglobulin-like
IPR007110 1340 1423 PS50835 Immunoglobulin-like
IPR007110 1428 1511 PS50835 Immunoglobulin-like
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f GTCACTGAGAAGCCAAGCGTC
Primer_r CATCCTTGGTCCAGCACACAG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 1
Experimental conditions
Panel name RH-map
Primer_f GTCACTGAGAAGCCAAGCGTC
Primer_r CATCCTTGGTCCAGCACACAG
PCR product length 124 bp
PCR conditions 95 °C15 sec66 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp