Order Kazusa clone(s) from : ![]() |
Product ID | ORK04595 |
---|---|
Accession No | AB040929 |
Description | contactin 3 (plasmacytoma associated) |
Clone name | fj09513 |
Vector information | |
cDNA sequence | DNA sequence (4594 bp) Predicted protein sequence (920 aa) |
Source | Human fetal brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1830 bp |
---|---|
Genome contig ID | gi89161205r_74294412 |
PolyA signal sequence (AATAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 3 | r | 74394412 | 74556781 | 19 | 99.9 | Terminal No-hit |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR013151 | 29 | 90 | PF00047 | Immunoglobulin |
IPR013098 | 119 | 206 | PF07679 | Immunoglobulin I-set | |
IPR013098 | 210 | 295 | PF07679 | Immunoglobulin I-set | |
IPR013098 | 300 | 388 | PF07679 | Immunoglobulin I-set | |
IPR013151 | 406 | 471 | PF00047 | Immunoglobulin | |
IPR003961 | 490 | 579 | PF00041 | Fibronectin | |
IPR003961 | 592 | 682 | PF00041 | Fibronectin | |
IPR003961 | 694 | 783 | PF00041 | Fibronectin | |
IPR003961 | 795 | 878 | PF00041 | Fibronectin | |
HMMSmart | IPR003599 | 21 | 109 | SM00409 | Immunoglobulin subtype |
IPR003598 | 27 | 95 | SM00408 | Immunoglobulin subtype 2 | |
IPR003599 | 126 | 207 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 132 | 196 | SM00408 | Immunoglobulin subtype 2 | |
IPR003599 | 216 | 296 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 222 | 285 | SM00408 | Immunoglobulin subtype 2 | |
IPR003599 | 308 | 389 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 314 | 378 | SM00408 | Immunoglobulin subtype 2 | |
IPR003599 | 398 | 487 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 404 | 476 | SM00408 | Immunoglobulin subtype 2 | |
IPR003961 | 490 | 576 | SM00060 | Fibronectin | |
IPR003961 | 593 | 679 | SM00060 | Fibronectin | |
IPR003961 | 695 | 780 | SM00060 | Fibronectin | |
IPR003961 | 795 | 875 | SM00060 | Fibronectin | |
ProfileScan | IPR007110 | 14 | 100 | PS50835 | Immunoglobulin-like |
IPR007110 | 119 | 205 | PS50835 | Immunoglobulin-like | |
IPR007110 | 210 | 294 | PS50835 | Immunoglobulin-like | |
IPR007110 | 300 | 389 | PS50835 | Immunoglobulin-like | |
IPR007110 | 391 | 485 | PS50835 | Immunoglobulin-like | |
IPR003961 | 490 | 585 | PS50853 | Fibronectin | |
IPR003961 | 592 | 690 | PS50853 | Fibronectin | |
IPR003961 | 694 | 790 | PS50853 | Fibronectin | |
IPR003961 | 795 | 884 | PS50853 | Fibronectin |
![]() |
Primer_f | GGAATGCCACAGACACTAAAG |
---|---|
Primer_r | GTCCTCTTTAATGGGCAGCAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |