KIAA1496

Product ID	ORK04595
Accession No	AB040929
Description	contactin 3 (plasmacytoma associated)
Clone name	fj09513
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4594 bp) Predicted protein sequence (920 aa)
Source	Human fetal brain

Length: 4594 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1830 bp
Genome contig ID	gi89161205r_74294412
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TATTATTTTCTATTCTAATAAAATTTATAACAAGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAATGAGTGTGCAGTATTAATTGCGGTATGGTCAAAGAAGAATGTCTACA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	r	74394412	74556781	19	99.9	Terminal No-hit

Length: 920 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10467	100.0	contactin-3 pre...	synthetic construct
Q9P232	100.0	Contactin-3; Br...	Homo sapiens
XP_526232	99.8	contactin 3 iso...	Pan troglodytes
XP_001143126	99.6	contactin 3 iso...	Pan troglodytes
XP_001143207	99.5	contactin 3 iso...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002341	5.6e-61	29.5	KIAA0343
AB018299	3.5e-35	28.3	KIAA0756
AB032958	9.9e-32	24.9	KIAA1132
AB046788	2e-23	27.5	KIAA1568
AB040947	3.8e-13	30.8	KIAA1514

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013151	29	90	PF00047	Immunoglobulin
	IPR013098	119	206	PF07679	Immunoglobulin I-set
	IPR013098	210	295	PF07679	Immunoglobulin I-set
	IPR013098	300	388	PF07679	Immunoglobulin I-set
	IPR013151	406	471	PF00047	Immunoglobulin
	IPR003961	490	579	PF00041	Fibronectin
	IPR003961	592	682	PF00041	Fibronectin
	IPR003961	694	783	PF00041	Fibronectin
	IPR003961	795	878	PF00041	Fibronectin
HMMSmart	IPR003599	21	109	SM00409	Immunoglobulin subtype
	IPR003598	27	95	SM00408	Immunoglobulin subtype 2
	IPR003599	126	207	SM00409	Immunoglobulin subtype
	IPR003598	132	196	SM00408	Immunoglobulin subtype 2
	IPR003599	216	296	SM00409	Immunoglobulin subtype
	IPR003598	222	285	SM00408	Immunoglobulin subtype 2
	IPR003599	308	389	SM00409	Immunoglobulin subtype
	IPR003598	314	378	SM00408	Immunoglobulin subtype 2
	IPR003599	398	487	SM00409	Immunoglobulin subtype
	IPR003598	404	476	SM00408	Immunoglobulin subtype 2
	IPR003961	490	576	SM00060	Fibronectin
	IPR003961	593	679	SM00060	Fibronectin
	IPR003961	695	780	SM00060	Fibronectin
	IPR003961	795	875	SM00060	Fibronectin
ProfileScan	IPR007110	14	100	PS50835	Immunoglobulin-like
	IPR007110	119	205	PS50835	Immunoglobulin-like
	IPR007110	210	294	PS50835	Immunoglobulin-like
	IPR007110	300	389	PS50835	Immunoglobulin-like
	IPR007110	391	485	PS50835	Immunoglobulin-like
	IPR003961	490	585	PS50853	Fibronectin
	IPR003961	592	690	PS50853	Fibronectin
	IPR003961	694	790	PS50853	Fibronectin
	IPR003961	795	884	PS50853	Fibronectin

Primer_f	GGAATGCCACAGACACTAAAG
Primer_r	GTCCTCTTTAATGGGCAGCAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-