KIAA0343

Product ID	ORK01070
Accession No	AB002341
Description	neuronal cell adhesion molecule, transcript variant 6
Clone name	hg01457
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6218 bp) Predicted protein sequence (1187 aa)
HaloTag ORF Clone	FHC01070
Flexi ORF Clone	FXC01070
Source	Human adult brain
Rouge ID	mKIAA0343 by Kazusa Mouse cDNA Project

Length: 6218 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2261 bp
Genome contig ID	gi89161213r_107475330
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- TCAAAAAAGTAACTATTAAACAGTCTTGATCTCTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TGTGACTTTTAACTTTTTCAAACATATATTGCCTAATGTTTTAAAATGGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	r	107575330	107827273	26	99.2	Both No-hit

Length: 1187 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG11167	100.0	neuronal cell a...	synthetic construct
AAI14571	99.9	NRCAM protein [...	Homo sapiens
AAV74326	99.7	neuronal cell a...	Pan troglodytes
EAW83427	98.8	neuronal cell a...	Homo sapiens
AAV74281	97.5	neuronal cell a...	Saimiri boliviensis

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018299	8.6e-65	51.2	KIAA0756
AB040929	8.5e-55	29.9	KIAA1496
D86983	1.8e-15	33.2	KIAA0230
AB046788	1.1e-14	25.7	KIAA1568
AB018349	2e-12	28.9	KIAA0806

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013098	53	147	PF07679	Immunoglobulin I-set
	IPR013151	167	227	PF00047	Immunoglobulin
	IPR013098	256	345	PF07679	Immunoglobulin I-set
	IPR013098	349	437	PF07679	Immunoglobulin I-set
	IPR013098	442	530	PF07679	Immunoglobulin I-set
	IPR013098	536	621	PF07679	Immunoglobulin I-set
	IPR003961	635	721	PF00041	Fibronectin
	IPR003961	734	822	PF00041	Fibronectin
	IPR003961	833	928	PF00041	Fibronectin
	IPR003961	940	1029	PF00041	Fibronectin
HMMSmart	IPR003599	60	149	SM00409	Immunoglobulin subtype
	IPR003598	66	137	SM00408	Immunoglobulin subtype 2
	IPR003599	159	246	SM00409	Immunoglobulin subtype
	IPR003598	165	232	SM00408	Immunoglobulin subtype 2
	IPR003599	265	346	SM00409	Immunoglobulin subtype
	IPR003598	271	335	SM00408	Immunoglobulin subtype 2
	IPR003599	355	438	SM00409	Immunoglobulin subtype
	IPR003598	361	427	SM00408	Immunoglobulin subtype 2
	IPR003599	449	531	SM00409	Immunoglobulin subtype
	IPR003598	455	520	SM00408	Immunoglobulin subtype 2
	IPR003599	540	622	SM00409	Immunoglobulin subtype
	IPR003598	546	611	SM00408	Immunoglobulin subtype 2
	IPR003961	635	718	SM00060	Fibronectin
	IPR003961	735	818	SM00060	Fibronectin
	IPR003961	834	925	SM00060	Fibronectin
	IPR003961	940	1025	SM00060	Fibronectin
ProfileScan	IPR007110	53	141	PS50835	Immunoglobulin-like
	IPR007110	148	242	PS50835	Immunoglobulin-like
	IPR007110	255	344	PS50835	Immunoglobulin-like
	IPR007110	349	436	PS50835	Immunoglobulin-like
	IPR007110	442	529	PS50835	Immunoglobulin-like
	IPR007110	534	620	PS50835	Immunoglobulin-like
	IPR003961	635	727	PS50853	Fibronectin
	IPR003961	734	828	PS50853	Fibronectin
	IPR003961	833	935	PS50853	Fibronectin
	IPR003961	940	1034	PS50853	Fibronectin
ScanRegExp	IPR003006	553	559	PS00290	Immunoglobulin/major histocompatibility complex motif

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	20	SAGRVPLILFLCQMISALEVPLD	42	SECONDARY	23
SOSUI2	2	1051	GWFIGLMCAVALLILILLIVCFI	1073	PRIMARY	23

Primer_f	GCATTCTTTATCCCCTGTTTG
Primer_r	TCCACTGGGCTAGACACCTCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GCATTCTTTATCCCCTGTTTG
Primer_r	TCCACTGGGCTAGACACCTCC
PCR product length	124 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles