KIAA1568

Product ID	ORK00247
Accession No	AB046788
Description	roundabout guidance receptor 2, transcript variant 2
Clone name	fh22308
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5598 bp) Predicted protein sequence (1380 aa)
HaloTag ORF Clone	FHC00247
Flexi ORF Clone	FXC00247
Source	Human fetal brain
Rouge ID	mKIAA1568 by Kazusa Mouse cDNA Project

Length: 5598 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1455 bp
Genome contig ID	gi89161205f_77072621
PolyA signal sequence (AATAAA,-29)	+--------+--------+----*----+---- TTTTTAAATAAAACCAGACCTTGTAAGTGGACATT
Flanking genome sequence (706732 - 706781)	----+--------+--------+--------+--------+----* AATAATTGTCCTGCCTCATTTGTTTTCACGACTTTGACAACAAGAAGTTC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	f	77172621	77779351	26	99.7	Perfect prediction

Length: 1380 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9HCK4	100.0	Roundabout homo...	Homo sapiens
ABF83430	100.0	ROBO2 isoform a...	Homo sapiens
XP_001144482	100.0	roundabout, axo...	Pan troglodytes
XP_544815	97.8	similar to Roun...	Canis lupus fam...
XP_001498832	97.8	similar to Roun...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB032958	1.1e-15	27.5	KIAA1132
D86983	1.3e-15	30.5	KIAA0230
AB040929	2.9e-13	27.6	KIAA1496
AB037776	1.4e-09	26.0	KIAA1355
AB002341	5.1e-09	25.5	KIAA0343

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013098	33	130	PF07679	Immunoglobulin I-set
	IPR013098	135	223	PF07679	Immunoglobulin I-set
	IPR013098	227	312	PF07679	Immunoglobulin I-set
	IPR013098	316	410	PF07679	Immunoglobulin I-set
	IPR013098	420	507	PF07679	Immunoglobulin I-set
	IPR003961	524	609	PF00041	Fibronectin
	IPR003961	650	715	PF00041	Fibronectin
	IPR003961	738	828	PF00041	Fibronectin
HMMSmart	IPR003599	39	131	SM00409	Immunoglobulin subtype
	IPR003598	45	119	SM00408	Immunoglobulin subtype 2
	IPR003599	141	224	SM00409	Immunoglobulin subtype
	IPR003598	147	212	SM00408	Immunoglobulin subtype 2
	IPR003599	233	313	SM00409	Immunoglobulin subtype
	IPR003598	239	302	SM00408	Immunoglobulin subtype 2
	IPR003596	243	297	SM00406	Immunoglobulin V-set
	IPR003599	322	411	SM00409	Immunoglobulin subtype
	IPR003598	328	400	SM00408	Immunoglobulin subtype 2
	IPR003596	332	395	SM00406	Immunoglobulin V-set
	IPR003599	426	508	SM00409	Immunoglobulin subtype
	IPR003598	432	497	SM00408	Immunoglobulin subtype 2
	IPR003596	436	492	SM00406	Immunoglobulin V-set
	IPR003961	524	606	SM00060	Fibronectin
	IPR003961	640	723	SM00060	Fibronectin
	IPR003961	738	825	SM00060	Fibronectin
ProfileScan	IPR007110	33	129	PS50835	Immunoglobulin-like
	IPR007110	135	222	PS50835	Immunoglobulin-like
	IPR007110	227	311	PS50835	Immunoglobulin-like
	IPR007110	316	411	PS50835	Immunoglobulin-like
	IPR007110	419	506	PS50835	Immunoglobulin-like
	IPR003961	524	615	PS50853	Fibronectin
	IPR003961	636	733	PS50853	Fibronectin
	IPR003961	738	834	PS50853	Fibronectin

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	1	VKMSLLMFTQLLLCGFLYVRVD	22	PRIMARY	22

Primer_f	AGGGAAGGAATGACAGATGAG
Primer_r	CTATGTCAAGAAGGTCGCTGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-