KIAA1786

Product ID	ORK00918
Accession No	AB058689
Description	transmembrane protein 132B
Clone name	fh19009
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5546 bp) Predicted protein sequence (400 aa)
Source	Human fetal brain
Rouge ID	mKIAA1786 by Kazusa Mouse cDNA Project

Length: 5546 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	4342 bp
Genome contig ID	gi89161190f_124300204
PolyA signal sequence (None)	+--------+--------+----*----+---- ACCCCAGCCCGGGTGACAGAGCGAGACTCCGTCTC
Flanking genome sequence (339778 - 339827)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAAAAAGAAATACCTGAGACCGGGTAACTTA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	f	124400204	124639980	5	99.1	Perfect prediction

Length: 400 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW98476	5.5e-173	100.0	transmembrane p...	Homo sapiens
Q14DG7	4.2e-161	96.1	Transmembrane p...	Homo sapiens
EAW98477	4.3e-161	96.1	transmembrane p...	Homo sapiens
XP_543363	3.1e-144	84.6	similar to CG14...	Canis lupus fam...
XP_001103750	6.4e-143	85.9	similar to CG14...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046803	2.2e-12	30.5	KIAA1583

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f	TTAAGCAAGAGACAGTTTCGG
Primer_r	CTATGTGTGCAGGTTTTAAGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-