KIAA1551

Product ID	ORK04312
Accession No	AB046771
Description	KIAA1551
Clone name	fh21239
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3829 bp) Predicted protein sequence (1249 aa)
Source	Human fetal brain
Rouge ID	mKIAA1551 by Kazusa Mouse cDNA Project

Length: 3829 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	78 bp
Genome contig ID	gi89161190f_31925654
PolyA signal sequence (AATAAA,-31)	+--------+--------+----*----+---- TATGAATAAAAACAGCATTGTTCAGAAATACCTTC
Flanking genome sequence	None

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	f	32025654	32029351	1	99.0	Terminal No-hit

Length: 1249 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW88538	99.7	chromosome 12 o...	Homo sapiens
Q9HCM1	99.7	Uncharacterized...	Homo sapiens
EAW88537	99.7	chromosome 12 o...	Homo sapiens
AAI40820	99.6	Chromosome 12 o...	Homo sapiens
XP_001084139	92.1	similar to Stre...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

RT-PCR-ELISA

Experimental conditions

Primer_f	GGCCAGCAAACTACATACCAG
Primer_r	ACTACATAGGGTTGATCATCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 12

Experimental conditions

Panel name	CCR
Primer_f	GGCCAGCAAACTACATACCAG
Primer_r	ACTACATAGGGTTGATCATCC
PCR product length	155 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp