KIAA1567

Product ID	ORK04871
Accession No	AB046787
Description	argonaute RISC catalytic component 4
Clone name	fh22119
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5990 bp) Predicted protein sequence (924 aa)
Source	Human fetal brain
Rouge ID	mKIAA1567 by Kazusa Mouse cDNA Project

Length: 5990 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3214 bp
Genome contig ID	gi89161185f_35955069
PolyA signal sequence (None)	+--------+--------+----*----+---- CTCCAGCCTGGGCAACAAGAGCGAAACTCTGTCTC
Flanking genome sequence (139940 - 139989)	----+--------+--------+--------+--------+----* AAAAAAAAAAAGGGGGGGGGGGGACATTAAGAGAGTGGTGATGACCCAAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	36046415	36095007	18	100.0	Perfect prediction

Length: 924 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAC26738	95.8	unnamed protein...	Mus musculus
XP_524663	95.3	eukaryotic tran...	Pan troglodytes
Q9HCK5	100.0	Eukaryotic tran...	Homo sapiens
XP_606455	99.5	similar to euka...	Bos taurus
AAH96023	98.8	Eukaryotic tran...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR014811	228	280	PF08699	Domain of unknown function DUF1785
	IPR003100	288	424	PF02170	Argonaute and Dicer protein
	IPR003165	572	883	PF02171	Stem cell self-renewal protein Piwi
ProfileScan	IPR003100	288	401	PS50821	Argonaute and Dicer protein
ProfileScan	IPR003165	572	883	PS50822	Stem cell self-renewal protein Piwi

Primer_f	TTCTCTATCCAGGACATCAGG
Primer_r	ATTTCCCCACCAGCAGTTTCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	CCR
Primer_f	TTCTCTATCCAGGACATCAGG
Primer_r	ATTTCCCCACCAGCAGTTTCC
PCR product length	157 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles