Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00595 |
---|---|
Accession No | AB014559 |
Description | diacylglycerol lipase, alpha |
Clone name | fh22726 |
Vector information | |
cDNA sequence | DNA sequence (5687 bp) Predicted protein sequence (1049 aa) |
HaloTag ORF Clone |
FHC00595
|
Flexi ORF Clone | FXC00595 |
Source | Human fetal brain |
Rouge ID |
mKIAA0659
by Kazusa Mouse cDNA Project
|
Note | We replaced hk01892, former representative clones for KIAA0659 with fh22726. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 2447 bp |
---|---|
Genome contig ID | gi51511727f_61104486 |
PolyA signal sequence (TATAAA,-7) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (166502 - 166551) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 11 | f | 61204486 | 61270986 | 20 | 99.4 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR002921 | 401 | 541 | PF01764 | Lipase |
ScanRegExp | IPR008262 | 473 | 482 | PS00120 | Lipase |
IPR001844 | 881 | 892 | PS00296 | Chaperonin Cpn60 |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 32 | LFLLHTTWFVILSVVLFGLVYNP | 54 | PRIMARY | 23 | 2 | 64 | DHGRGYLGILLSCMIAEMAIIWL | 86 | SECONDARY | 23 | 3 | 104 | VLYVRLAILVIEFIYAIVGIVWL | 126 | PRIMARY | 23 | 4 | 142 | TLGMVVCNWVVILSVCITVLCVF | 164 | PRIMARY | 23 |
---|
RT-PCR |
---|
Primer_f | GCATACAGAGCTTCAGCCCAG |
---|---|
Primer_r | TGCCCACATTAGAGGTCCCAG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GCATACAGAGCTTCAGCCCAG |
Primer_r | TGCCCACATTAGAGGTCCCAG |
PCR product length | 186 bp |
PCR conditions | 95 °C15 sec66 °C60 sec30 cycles |