KIAA1571

Product ID	ORK07410
Accession No	AB046791
Description	zinc finger, DBF-type containing 2
Clone name	fh22968s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (8172 bp) Predicted protein sequence (1779 aa)
Source	Human fetal brain
Note	We replaced fh22968, former representative clones for KIAA1571 with fh22968s1. (2003/8/28)

Length: 8172 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2831 bp
Genome contig ID	gi89161199f_206779222
PolyA signal sequence (ATTAAA,-11)	+--------+--------+----*----+---- TTTGATGTTATCAAGATAAAATTTATTAAACCTTG
Flanking genome sequence (108173 - 108222)	----+--------+--------+--------+--------+----* AAATTTGTCTGTTCTCTCTTCATGTTAGAAACTTTTTCTGGGAATACTTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	f	206879222	206887393	1	100.0	Perfect prediction

Length: 1779 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9HCK1	100.0	DBF4-type zinc ...	Homo sapiens
XP_001097564	85.1	hypothetical pr...	Macaca mulatta
EAW70385	100.0	hCG2012502 [Hom...	Homo sapiens
BAC85454	100.0	unnamed protein...	Homo sapiens
XP_001787346	52.4	similar to zinc...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	AGGACACTGCACCAACTCAAG
Primer_r	CTATGGCTGATTTTCGCTGTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 2

Experimental conditions

Panel name	CCR
Primer_f	AGGACACTGCACCAACTCAAG
Primer_r	CTATGGCTGATTTTCGCTGTC
PCR product length	181 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles