KIAA1741

Gene/Protein Characteristic Table for KIAA1741

Order Kazusa clone(s) from :

Product ID	ORK00274
Accession No	AB051528
Description	tankyrase 1 binding protein 1, 182kDa
Clone name	fh23254
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5785 bp) Predicted protein sequence (1777 aa)
HaloTag ORF Clone	FHC00274
Flexi ORF Clone	FXC00274
Source	Human fetal brain
Rouge ID	mKIAA1741 by Kazusa Mouse cDNA Project
Note	We replaced pj01271, former representative clones for KIAA1741 with fh23254. (2002/5/10)

Features of the cloned cDNA sequence

Description

Length: 5785 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	450 bp
Genome contig ID	gi51511727r_56723694
PolyA signal sequence (AATAAA,-16)	+--------+--------+----*----+---- TTTGCCACTTGAAACAATAAATAAAGTTTTTTGGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATTGGTGCTGTCCAGGTGGTGGTACGTGGTCATGGCTGCCCATTTCCTC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	r	56823694	56848969	12	99.6	Perfect prediction

Features of the protein sequence

Description

Length: 1777 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW73731	100.0	tankyrase 1 bin...	Homo sapiens
Q9C0C2	99.9	182 kDa tankyra...	Homo sapiens
AAM15531	99.7	182kDa tankyras...	Homo sapiens
XP_001093186	95.8	tankyrase 1-bin...	Macaca mulatta
XP_540615	75.3	similar to 182 ...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	CTCAGGGTCAGAAGGATCGTC
Primer_r	ATAAATGTGCCTCCCCAGACG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 11

Experimental conditions

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp