KIAA1680

Product ID	ORK05701
Accession No	AB051467
Description	coiled-coil serine-rich protein 1
Clone name	fh23414
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone fh23414 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCCC ACGCGTCCG) instead of regular one (GTCGACCCAC GCGTCCG).
cDNA sequence	DNA sequence (5833 bp) Predicted protein sequence (902 aa)
Source	Human fetal brain
Rouge ID	mKIAA1680 by Kazusa Mouse cDNA Project

Length: 5833 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2842 bp
Genome contig ID	gi89161207f_91167759
PolyA signal sequence (AATAAA,-31)	+--------+--------+----*----+---- CTGAAATAAACTGTTCCCATTTTTATAATTATTGG
Flanking genome sequence (1574316 - 1574365)	----+--------+--------+--------+--------+----* AACATGAAACTGTATTTCTATGAACTCAATGATTTTTTTCCATAAAATTA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	f	91267759	92742073	7	99.4	Internal No-hit

Length: 902 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001095828	0	97.4	similar to gran...	Macaca mulatta
XP_001162951	0	98.5	hypothetical pr...	Pan troglodytes
XP_001495561	0	90.1	hypothetical pr...	Equus caballus
EDK98765	4.1e-203	79.1	mCG122811, isof...	Mus musculus
XP_420481	3.1e-162	66.0	hypothetical pr...	Gallus gallus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	CATCTAAAGTTCCCACCATAC
Primer_r	ACAGACACCAACATTTAGGAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 4

Experimental conditions

Panel name	CCR
Primer_f	CATCTAAAGTTCCCACCATAC
Primer_r	ACAGACACCAACATTTAGGAC
PCR product length	153 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles