Order Kazusa clone(s) from : ![]() |
Product ID | ORK07386 |
---|---|
Accession No | AB075846 |
Description | YTH domain containing 1 |
Clone name | fh23421 |
Vector information | |
cDNA sequence | DNA sequence (5142 bp) Predicted protein sequence (480 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1966
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | Warning |
Length of 3'UTR | 3699 bp |
---|---|
Genome contig ID | gi89161207r_68758713 |
PolyA signal sequence (AATAAA,-18) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 4 | r | 68858713 | 68885481 | 14 | 99.2 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | CAGGGTATTTAAAGGATCCAC |
---|---|
Primer_r | GCTGATAGTAAGGATGGTGTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |