KIAA1966

Product ID	ORK07386
Accession No	AB075846
Description	YTH domain containing 1
Clone name	fh23421
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5142 bp) Predicted protein sequence (480 aa)
Source	Human fetal brain
Rouge ID	mKIAA1966 by Kazusa Mouse cDNA Project

Length: 5142 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	3699 bp
Genome contig ID	gi89161207r_68758713
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- CTGTTGTCTTAAATACTAATAAATACATTAAATGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATCTTAAATACTACTATGTCTTAAACACAGACTATTGACTATTAAATATT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	r	68858713	68885481	14	99.2	Perfect prediction

Length: 480 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_517262	6.3e-164	100.0	splicing factor...	Pan troglodytes
Q96MU7	6.3e-164	100.0	YTH domain-cont...	Homo sapiens
EDL89830	5.5e-162	97.7	splicing factor...	Rattus norvegicus
XP_001501576	8.8e-162	99.0	similar to spli...	Equus caballus
NP_808348	8.8e-162	97.5	YTH domain cont...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007275	152	248	PF04146	YT521-B-like protein
ProfileScan	IPR007275	108	245	PS50882	YT521-B-like protein

Primer_f	CAGGGTATTTAAAGGATCCAC
Primer_r	GCTGATAGTAAGGATGGTGTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-