KIAA1682

Product ID	ORK00265
Accession No	AB051469
Description	myotubularin related protein 12, transcript variant 1
Clone name	fh23774
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5034 bp) Predicted protein sequence (775 aa)
HaloTag ORF Clone	FHC00265
Flexi ORF Clone	FXC00265
Source	Human fetal brain
Rouge ID	mKIAA1682 by Kazusa Mouse cDNA Project

Length: 5034 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2687 bp
Genome contig ID	gi51511721r_32162869
PolyA signal sequence (ATTAAA,-24)	+--------+--------+----*----+---- TGATTGCAGAAATTAAAGCACAATTTACAAGCAAT
Flanking genome sequence (285936 - 285887)	----+--------+--------+--------+--------+----* GCTGGGATTACAATACAGGCATGAGCCACCGTGCCCGCCCCAGAAAATTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	r	32256535	32348804	19	98.6	Terminal No-hit

Length: 775 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001089010	98.8	similar to phos...	Macaca mulatta
Q9C0I1	100.0	Myotubularin-re...	Homo sapiens
AAK26171	99.9	phosphatidylino...	Homo sapiens
Q5R989	98.5	Myotubularin-re...	Pongo abelii
XP_855452	93.8	similar to myot...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB028996	8.7e-16	27.6	KIAA1073
AB002369	1.1e-14	34.9	KIAA0371
AB014547	1.7e-13	32.2	KIAA0647

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010569	261	325	PF06602	Myotubularin-related

Primer_f	CTCCAGCGACATTCCTCTAAG
Primer_r	TAGCGTGACACAAATCCAGGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	CCR
Primer_f	GTTTGTTGTTACCGCATATCG
Primer_r	CTTCTCTTGTAAACTCTGGAC
PCR product length	158 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles