KIAA1574

Product ID	ORK04964
Accession No	AB046794
Description	HAUS augmin-like complex, subunit 6
Clone name	fh24775
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5214 bp) Predicted protein sequence (670 aa)
Source	Human fetal brain
Rouge ID	mKIAA1574 by Kazusa Mouse cDNA Project

Length: 5214 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3199 bp
Genome contig ID	gi89161216r_18943142
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- TTAAATACTGTTGTTTTCAATAAATATTTTATACT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATCTGGCTCTGGAATTTCCTATATAATCTCAAAAAGAACTATGCCCCTGC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	r	19043142	19072887	10	99.3	Perfect prediction
Ensembl gnome browser	7	f	53223218	53902067	3	97.2	Perfect prediction

Length: 670 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH65935	100.0	FAM29A protein ...	Homo sapiens
Q7Z4H7	100.0	Protein FAM29A.	Homo sapiens
AAQ09022	100.0	unknown protein...	Homo sapiens
AAI11042	99.9	FAM29A protein ...	Homo sapiens
CAL38345	99.9	hypothetical pr...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	TCCCAAACACCCGAAAGACAC
Primer_r	GATGGACGTGCGTAAAGATGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 7

Experimental conditions

Panel name	RH-map
Primer_f	TCCCAAACACCCGAAAGACAC
Primer_r	GATGGACGTGCGTAAAGATGG
PCR product length	135 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles