KIAA1688

Product ID	ORK00887
Accession No	AB051475
Description	Rho GTPase activating protein 39
Clone name	fh26207
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5054 bp) Predicted protein sequence (1094 aa)
HaloTag ORF Clone	FHC00887
Flexi ORF Clone	FXC00887
Source	Human fetal brain
Rouge ID	mKIAA1688 by Kazusa Mouse cDNA Project

Length: 5054 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1243 bp
Genome contig ID	gi51511724r_145625371
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- GACGACACGAGTGAATAAAGTGCACATGGACCCTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CGCGTCCTCCCGTTCCTTGTGGGCGCGGCCGGGGGCGGGAAGAGACGCGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	8	r	145725371	145809699	12	100.0	Perfect prediction

Length: 1094 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG59035	99.9	unnamed protein...	Homo sapiens
AAH60637	88.8	DNA segment, Ch...	Mus musculus
NP_775145	86.5	preoptic regula...	Rattus norvegicus
EDM15938	86.5	rCG59984 [Rattu...	Rattus norvegicus
EDL29616	86.5	DNA segment, Ch...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D29642	0.00053	31.3	KIAA0053

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001202	37	67	PF00397	WW/Rsp5/WWP
	IPR001202	76	106	PF00397	WW/Rsp5/WWP
	IPR000857	772	890	PF00784	Unconventional myosin/plant kinesin-like protein/non-motor protein conserved region MyTH4
	IPR000198	920	1066	PF00620	RhoGAP
HMMSmart	IPR001202	36	69	SM00456	WW/Rsp5/WWP
	IPR001202	75	108	SM00456	WW/Rsp5/WWP
	IPR000857	733	875	SM00139	Unconventional myosin/plant kinesin-like protein/non-motor protein conserved region MyTH4
	IPR000198	917	1090	SM00324	RhoGAP
ProfileScan	IPR001202	74	108	PS50020	WW/Rsp5/WWP
	IPR000857	733	890	PS51016	Unconventional myosin/plant kinesin-like protein/non-motor protein conserved region MyTH4
	IPR000198	901	1089	PS50238	RhoGAP

Primer_f	AGAATCTATCCTGCATCGCAG
Primer_r	GGTAGAGCTTGGTTTTTGGTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	CCR
Primer_f	AGAATCTATCCTGCATCGCAG
Primer_r	GGTAGAGCTTGGTTTTTGGTC
PCR product length	209 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles