KIAA1430

Product ID	ORK01165
Accession No	AB037851
Description	cilia and flagella associated protein 97, transcript variant 1
Clone name	fj00020
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4282 bp) Predicted protein sequence (527 aa)
HaloTag ORF Clone	FHC01165
Flexi ORF Clone	FXC01165
Source	Human fetal brain
Rouge ID	mKIAA1430 by Kazusa Mouse cDNA Project

Length: 4282 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2696 bp
Genome contig ID	gi89161207r_186218250
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- AGCTATTACTCCAAATAAAGTTCTTTGGTTTGCTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAATGTAGTGTAATGCAGTTGTTTTCTCTCCGCTAACCTGAGTGTCCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	r	186318250	186349331	4	99.3	Perfect prediction

Length: 527 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001084789	8.9e-168	95.4	hypothetical pr...	Macaca mulatta
XP_001084669	3.9e-167	95.3	hypothetical pr...	Macaca mulatta
XP_001491159	1.3e-129	76.9	hypothetical pr...	Equus caballus
XP_001369037	1.4e-98	64.3	similar to hCG9...	Monodelphis dom...
XP_001925075	7.2e-97	72.5	hypothetical pr...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	GTGGACCATTCTTTCTTTGAC
Primer_r	GTTGTTTGCATTCCAGTGTTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 4

Experimental conditions

Panel name	GeneBridge 4
Primer_f	GTGGACCATTCTTTCTTTGAC
Primer_r	GTTGTTTGCATTCCAGTGTTC
PCR product length	146 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles