Order Kazusa clone(s) from : ![]() |
Product ID | ORK00859 |
---|---|
Accession No | AB040973 |
Description | G protein-coupled receptor 83 |
Clone name | fj00652 |
Vector information | |
cDNA sequence | DNA sequence (4109 bp) Predicted protein sequence (424 aa) |
HaloTag ORF Clone |
FHC00859
![]() |
Flexi ORF Clone | FXC00859 |
Source | Human fetal brain |
Rouge ID |
mKIAA1540
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 2832 bp |
---|---|
Genome contig ID | gi51511727r_93650131 |
PolyA signal sequence (AATAAA,-25) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 11 | r | 93750131 | 93774066 | 4 | 99.2 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR000276 | 74 | 98 | PR00237 | Rhodopsin-like GPCR superfamily |
IPR000611 | 99 | 111 | PR01012 | Neuropeptide Y receptor | |
IPR000276 | 107 | 128 | PR00237 | Rhodopsin-like GPCR superfamily | |
IPR000611 | 129 | 141 | PR01012 | Neuropeptide Y receptor | |
IPR000611 | 152 | 167 | PR01012 | Neuropeptide Y receptor | |
IPR000276 | 152 | 174 | PR00237 | Rhodopsin-like GPCR superfamily | |
IPR000276 | 186 | 207 | PR00237 | Rhodopsin-like GPCR superfamily | |
IPR000276 | 241 | 264 | PR00237 | Rhodopsin-like GPCR superfamily | |
IPR000276 | 291 | 315 | PR00237 | Rhodopsin-like GPCR superfamily | |
IPR000276 | 328 | 354 | PR00237 | Rhodopsin-like GPCR superfamily | |
IPR000611 | 333 | 342 | PR01012 | Neuropeptide Y receptor | |
IPR000611 | 344 | 357 | PR01012 | Neuropeptide Y receptor | |
HMMPfam | IPR000276 | 89 | 346 | PF00001 | Rhodopsin-like GPCR superfamily |
ProfileScan | IPR000276 | 89 | 346 | PS50262 | Rhodopsin-like GPCR superfamily |
ScanRegExp | IPR000276 | 158 | 174 | PS00237 | Rhodopsin-like GPCR superfamily |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 1 | KMVPHLLLLCLLPLVRATEPH | 21 | SECONDARY | 21 | 2 | 73 | ALLIVAYSFIIVFSLFGNVLVCH | 95 | PRIMARY | 23 | 3 | 115 | AVADIMITLLNTPFTLVRFVNST | 137 | SECONDARY | 23 | 4 | 187 | GVIYIAVIWTMATFFSLPHAICQ | 209 | SECONDARY | 23 | 5 | 241 | DLATFILLYILPLLIISVAYARV | 263 | PRIMARY | 23 | 6 | 295 | LMLVVVLFALCWFPLNCYVLLLS | 317 | PRIMARY | 23 |
---|
![]() |
Primer_f | ATGATTCCTTCTCTCCTGCAA |
---|---|
Primer_r | CATTATTTAGACAACACAGCG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |